-
E-mail
panzhaolongqiang@126.com
-
Phone
13045610204
-
Address
Lane 126, Shunhe Road, Pudong New Area, Shanghai
Product Categories
Shanghai Linzhao Biotechnology Co., Ltd
Imported NovoNGS ChiTag molecules
NegotiableUpdate on 01/16
- Model
- Nature of the Manufacturer
- Producers
- Product Category
- Place of Origin
Overview
NovoNGS ChiTag 2.0 Transposome: NovoNGS ChiTagTM transposon is incubated with ChiTagTM enzyme and adapter, which has the function of breaking double stranded DNA and inserting adapter, and has the activity of binding to antibodies. Based on its function, we applied it to CUT Tag。 Produced by Shanghai Nearshore Technology.
Product Details
NovoNGS ChiTag 2.0 TransposomeProduced by Shanghai Nearshore Technology.
CUT&Tag is a new method for studying protein DNA interactions, which has the following advantages compared to traditional ChIP Seq: time-saving and efficient, requires fewer cells, low background signal, good repeatability, and can even be used for single-cell level sequencing. CUT&Tag is a powerful tool for studying the interaction between proteins and chromatin DNA in vivo, which has significant implications for gene regulation, epigenetics, and other research.
Version 2.0 ChiTagTMThe use of pAG-Tn5 replaced the original pA-Tn5, improving efficiency and removing restrictions on antibody selection.
NovoNGS ChiTag 2.0 Transposome：
Product Usage
Protein DNA interaction research can replace ChIP Seq and other methods; Specially suitable for efficient epigenetic analysis of small samples and single cells. |
Product performance:
This product is ChiTagTMThe transposon complex formed after incubation of proteins and adapters can break genomic DNA into small fragments and add library adapters. Through PCR amplification, a sequencing library suitable for Illumina high-throughput sequencing platform can be obtained. |
CUT&Tag experimental testing:
|
80000 cells were used for Cut&Tag experiments, and goat antibody was used as the secondary antibody. The PCR amplification results are as follows: The following figure shows that using pAG-Tn5 for CUT&Tag yields a higher library yield than pA-Tn5. Using pAG-Tn5 instead of pA-Tn5 can reduce the experimental requirements for secondary antibodies. Storage temperature: -20℃3 months, long-term storage -80℃. quality assurance After multiple column purifications, SDS-PAGE gel detection showed only a clear and single target band, while PCR method detected no host DNA residue and no contamination by nucleases. Single chain connector sequence: Adaptor 1: 5 ’ - tcgtcggcagcgtcagatgttaagagacag- 3 ’ Adaptor 2: 5 ’ - gtctcgtgggctcggagtgtataagagacag - 3 ’ ME: 5 '– pctgtcttatacacatct- 3' |
